2024 Protein tify 10a

Protein tify 10a

Author: mdrn

August undefined, 2024

WebbVegetative storage protein 2 5’ AGATCAATGGGCTGATTTGG 3’ (VSP2: AT5G24770) 5’ GTGTATACAAGGGGACAATGCG 3’ Transcription factor MYC2 5’ ATCTATACGCAAGAACAGC 3’ (MYC2: AT1G32640) 5’ GACCCCATAACTTTCTAAAC 3’ Protein TIFY 10A 5’ GTCTTCAAACCCTCAAAC 3’ Webb114319171 - Gene ResultLOC114319171 protein TIFY 10A [] Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. LOC114319171 protein TIFY 10A [] Gene ID: 114319171, updated on 25-Aug-2024 Summary Other designations protein TIFY 10A, jasmonate-zim-domain protein 1

Fasting induced JMJD3 histone demethylase epigenetically 2024

WebbThis article identified and characterized 34 TIFY genes in G. soja. Sequence analyses indicated that most GsTIFY proteins had two conserved domains: TIFY and Jas. Phylogenetic analyses suggested that these GsTIFY … Webb1 juni 2003 · Protein TIFY 10a Gene TIFY10A Status UniProtKB reviewed (Swiss-Prot) Organism Oryza sativa subsp. japonica (Rice) Amino acids 228 Protein existence Evidence at protein level Annotation score 3/5 Entry Feature viewer Publications External links History BLAST Download Add a publication Entry feedback Function Repressor of … i am bouncing

LOC107801671 protein TIFY 10A-like [ (common tobacco)]

Webb12 maj 2016 · After recognition component of the E3 ubiquitin ligase SCFCOI1, as a result, JAZ proteins are ubiquitinated and subsequently degraded in the 26S proteasome, releasing TFs from inhibition and activating JA-responsive gene transcription. WebbThe tify domain is required for homo- and heterodimerization and for the interaction with other TIFY proteins. The jas domain (302-326) is necessary and sufficient for the hormone dependent interaction with COI1 and the hormone independent interaction with MYC2. Sequence similarities Belongs to the TIFY/JAZ family. WebbGene ID: 109190423, updated on 3-Jun-2024. Summary Other designations. protein TIFY 10a-like moment of inertia formula of cone

A WRKY transcription factor, TaWRKY40‐D, promotes leaf

Q9LVI4 - UniProt

WebbProtein Protein TIFY 10A Gene TIFY10A Source organism Arabidopsis thaliana (Mouse-ear cress) go to search UniProt Q9LMA8 go to UniProt Experimental structures 4 structures in PDB for Q9LMA8 go to PDBe-KB Biological function Repressor of jasmonate responses. Jasmonoyl-isoleucine (JA-Ile) specifically promotes COI1-TIFY10A/JAZ1 interaction. http://cucurbitgenomics.org/feature/mRNA/Csa3G645940.1 moment of inertia formula wikipediaWebb1 juli 2024 · Other interaction proteins, including ferritin, WD-40 repeat-containing protein, ubiquitin conjugating enzyme, and protein TIFY 10A were involved in leaf and flower development (Supplementary... iam boundary

"WebbGene ID: 107801671, updated on 2-Jun-2024. Summary Other designations. protein TIFY 10A-like, JAZ1-like protein, JAZ1-like protein " - Protein tify 10a

Protein tify 10a

Webb28 aug. 2009 · Qi T, 0000-0003-1971-2481, Tsinghua University. The Plant Cell , 28 Aug 2009, 21 (8): 2220-2236. DOI: 10.1105/tpc.109.065730 PMID: 19717617. A comment on this article appears in "The jasmonate receptor: protein modeling and photoaffinity labeling reveal that the CORONATINE INSENSITIVE1 protein binds jasmonoyl-isoleucine and … WebbProtein TIFY 10A OS=Arabidopsi... sp Q10QW3 TI11B_ORYSJ: 6.1e-8: 37.5: Protein TIFY 11b OS=Oryza sati... sp Q9C5K8 TIF3B_ARATH: 8.8e-7: 35.3: Protein TIFY 3B OS=Arabidopsis... sp A2XSX6 TIF9_ORYSI: 1.1e-6: 36.7: Protein TIFY 9 …

Did you know?

Webb(RefSeq) protein TIFY 10a. KO: K13464 : jasmonate ZIM domain-containing protein: Organism: egr Eucalyptus grandis (rose gum) Pathway: egr04075 : Plant hormone signal transduction: Brite: KEGG Orthology (KO) [BR:egr00001] 09130 Environmental Information Processing 09132 Signal transduction 04075 Plant hormone signal transduction WebbThe TIFY family is a plant-specific gene family encoding proteins characterized by a conserved TIFY domain. This family encodes four subfamilies of proteins, including ZIM-like (ZML), TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. TIFY proteins play important roles in plant development and stress responses.

http://biotech.aiijournal.com/CN/10.13560/j.cnki.biotech.bull.1985.2024-0307 Webb21 okt. 2024 · Here, expressions of two JA-induced protein TIFY 10A and TIFY 10C were significantly increased in H5, suggesting that these two genes might be related to drought stress in chieh-qua. Genes analysis of ABA signal transduction. ABA plays an essential roles in the seed development, ...

WebbSWISS-MODEL Repository entry for Q9LMA8 (TI10A_ARATH), Protein TIFY 10A. Arabidopsis thaliana (Mouse-ear cress) Webb3 juli 2009 · JASMONATE ZIM-domain (JAZ) proteins belonging to the larger family of the TIFY proteins (Vanholme et al, 2007) act as repressors of JA signalling (Chini et al, 2007; Thines et al, 2007). Perception of bioactive JAs by the F-box protein CORONATINE INSENSITIVE 1 (COI1) causes degradation of JAZ proteins through the …

WebbPrinciples of Chemical Engineering Processes MATERIAL AND ENERGY BALANCES 4 SECOND EDITION NAYEF GHASEM AND REDHOUANE HENDA Principles of Chemical Engineering ...

WebbTIFY10B. F25A4.8, F25A4_8, JASMONATE-ZIM-DOMAIN PROTEIN 2, JAZ2, AT1G74950. protein TIFY 10B. GO Process (2) GO Function (1) GO Component (1) TAIR Entrez Gene RefSeq UniprotKB. Download Curated Data for this Protein. moment of inertia formula unitsWebb3 apr. 1998 · Page PAGE 10A, Image 10; The Forsyth County news. (Cumming, Ga.) 19??-current, April 03, 1998, Page PAGE 10A, Image 10. Previous Page Next Page. Previous Issue Next Issue. Clip Visible Area View Page Text View PDF. moment of inertia for solid sphereWebbPREDICTED: protein TIFY 10A-like [Jatropha curcas] gi 658035947 ref XP_008353511.1 7.8e-29: 41.26: PREDICTED: protein TIFY 10B-like [Malus domestica] Annotated Terms The following terms have been associated with this mRNA: Vocabulary: INTERPRO; Term Definition; IPR010399: Tify_dom: IPR018467: CCT_CS ... moment of inertia for square sectionWebb3 juni 2024 · protein TIFY 10a. Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. LOC110108135 protein TIFY 10a [] Gene ID: 110108135, updated on 3-Jun-2024. Summary. Other designations. protein TIFY 10a ... moment of inertia formula with forceWebbDuchenne muscular dystrophy (DMD) affects myofibers and muscle stem cells (SC), causing progressive muscle degeneration and repair defects. It was not known whether dystrophic myoblasts—the effector cells of muscle growth and regeneration—are i am bouncing on a big bad wolf comhttp://jcdb.liu-lab.com/index.php?m=Browser&a=detail&gene=JCDBG06410 i am bound but i will not breakWebbSeveral types of amyloid disease can be identified depending on the exact nature of the protein material and its distribution. The kidneys are often involved in systemic forms of amyloid, with 90% of primary amyloid patients show- ing proteinuria and 50% having a raised urea at the time of presentation; these findings also occur in myeloma- related … moment of inertia formula for shapes